View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19060_high_37 (Length: 201)
Name: NF19060_high_37
Description: NF19060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19060_high_37 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 26 - 201
Target Start/End: Original strand, 10366199 - 10366374
Alignment:
| Q |
26 |
gagttaacgagtttcacactaattgttagtgagaacttcagttcaatgtctcgatagaataattcaaatgacttacttgcatgttactaaagagagataa |
125 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10366199 |
gagttaatgagttttacactaattgttagtgagaacttcagttcaatgtctggatagaataattcaaatgacttacttgcatgttactaaagagagataa |
10366298 |
T |
 |
| Q |
126 |
ggcggttgttcatgcactctcacaagaggtatttagattagctccgatcttaccaaaaatatatgctcaaaagttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10366299 |
ggcggttgttcatgcactctcacaagaggtatttagattagctccgatcttaccaaaaatatatgctcaaaagttt |
10366374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University