View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19060_low_7 (Length: 496)
Name: NF19060_low_7
Description: NF19060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19060_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 173 - 478
Target Start/End: Complemental strand, 2176388 - 2176082
Alignment:
| Q |
173 |
gttttacttctaagaacaatttattcgagtcaatcagttaattattgattttcttgacattggaactgggcaatggaattggccaactttctatttatga |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176388 |
gttttacttctaagaacaatttattcgagtcaatcagttaattattgattttcttgacattggaactgggcaatggaattggccaactttctatttatga |
2176289 |
T |
 |
| Q |
273 |
tgatctgaatgatttggtttgacaaaagcatgttattttttagggaaggcttcccttcttgagcgttttatacatagataattttcagttatgtggtaga |
372 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176288 |
tgatctgaatgatttggtttgacaaaagcctgttattttttagggaaggcttcccttcttgagcgttttatacatagataattttcagttatgtggtaga |
2176189 |
T |
 |
| Q |
373 |
aagtttttatcagaggttcgtaaggc-nnnnnnnnaatggcaaggtaagaagatatatatcaactatgaagcacgaacaccgaacacgatactaacatgg |
471 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
2176188 |
aagtttttatcagaggttcgcaaggctttttttttaatggcaaggtaagaagatatatatcaactatgaagcacgaacaccagacacgacactgacatgg |
2176089 |
T |
 |
| Q |
472 |
acatgtc |
478 |
Q |
| |
|
||||||| |
|
|
| T |
2176088 |
acatgtc |
2176082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 11 - 108
Target Start/End: Complemental strand, 2176550 - 2176453
Alignment:
| Q |
11 |
cagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacatnnnnnnntgactgataatttgtattttcaacatctaact |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
2176550 |
cagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacataaaaaaatgactgataatttgtcttttcaacatctaact |
2176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University