View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19062_high_16 (Length: 363)
Name: NF19062_high_16
Description: NF19062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19062_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 14 - 266
Target Start/End: Complemental strand, 47681294 - 47681042
Alignment:
| Q |
14 |
agagacataggataagtatcccaaaaattattacatatcattttcaattgaaatagaggatcgggattggggtccaaaggttcacatgtacactatttga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47681294 |
agagacataggataagtatcccaaaaattattacatatcattttcaattgaaatagaggatcgggattggggtccaaaggttcacatgtacactatttga |
47681195 |
T |
 |
| Q |
114 |
gtgttgtccagtccattcacaactgtaatagaatatgaccctcatcatcaaggtcaaacttatctcattaccccacataacatattatagatatcccttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47681194 |
gtgttgtccagtccattcacaactgtaatagaatatgaccctcatcatcaaggtcaaacttatctcattaccccacataacatattatagatatcccttt |
47681095 |
T |
 |
| Q |
214 |
ccattggaaacacatgaagcaggaaattgcaggctctcatttctcttactctt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47681094 |
ccattggaaacacatgaagcaggaaattgcaggctctcatttctcttactctt |
47681042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University