View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19062_high_19 (Length: 321)
Name: NF19062_high_19
Description: NF19062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19062_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 7 - 307
Target Start/End: Complemental strand, 12435294 - 12434994
Alignment:
| Q |
7 |
ggagcagagatgggatgatgatgagattgaaggttattgttgcgacattccggggtctaactataaaacggtgtttgaattgttgaaaattcatcggaca |
106 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12435294 |
ggagcagtgatgggatgataatgagattgaaggttattgttgtgacattccggggtcgaactataaaacggtgtctgaattgttgaaaattcatcggaca |
12435195 |
T |
 |
| Q |
107 |
gctatggcgaaaaatcgagtctcaaccagatgtatgcctacgattcctggcatttgaattggcttagaatatgttggactgcttgtgacttgagttatct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12435194 |
gctatggcgaaaaatcgagtctcaaccagatgtatgcctacaattcctggcatttgaattggcttagaatatgttggactgcttgtgacttgagttatct |
12435095 |
T |
 |
| Q |
207 |
attacctgaaatcatttttgttatcttccttggtttcaagacatgtgctatgctttatgcagttgttttcttattttatttttcagtactattgttatat |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12435094 |
attacctgaaatcatttttgttatcttccttggtttcaagacatgtgctatgctttatgcagttgttttcttattttatttttcagtactattgttatat |
12434995 |
T |
 |
| Q |
307 |
t |
307 |
Q |
| |
|
| |
|
|
| T |
12434994 |
t |
12434994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University