View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19062_low_14 (Length: 375)
Name: NF19062_low_14
Description: NF19062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19062_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 41494680 - 41494915
Alignment:
| Q |
12 |
agagaactctcaatgcaaatattaataataattaaaatttataggcatgcgttgagtatggtttcttttaccttgtgaaccatggtgtggatgaggattt |
111 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41494680 |
agagaactctcgatgcaaatattaataataattaaaatttataggcatgcgttgagtatggtttcttttaccttgtgaaccatggtgtgaatgaggattt |
41494779 |
T |
 |
| Q |
112 |
tatgaagcaagtgtttgagcacagtgcaaagctcttctcacttcctctccaacacaaaatgaacttgatcctagtccactttccaaaggtatattcttat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41494780 |
tatgaagcaagtgtttgagcacagtgcaaagttcttctcacttcctctccaacacaaaatgaacttgatcctagtccactttccaaaggtatattcttat |
41494879 |
T |
 |
| Q |
212 |
ttttagatacttattttagttcataaattatagacg |
247 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41494880 |
ttttagatatttattttagttcataaattatagacg |
41494915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 45 - 156
Target Start/End: Original strand, 41489910 - 41490021
Alignment:
| Q |
45 |
aaaatttataggcatgcgttgagtatggtttcttttaccttgtgaaccatggtgtggatgaggattttatgaagcaagtgtttgagcacagtgcaaagct |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||| || |||| || || || |||||||| | |
|
|
| T |
41489910 |
aaaatttataggcatgcgttgagtatggttttttttaccttgtgaaccacggtgtggacgaggattttatcaaacaagcattcgatcagagtgcaaactt |
41490009 |
T |
 |
| Q |
145 |
cttctcacttcc |
156 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41490010 |
cttctcacttcc |
41490021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 51 - 156
Target Start/End: Original strand, 41480799 - 41480904
Alignment:
| Q |
51 |
tataggcatgcgttgagtatggtttcttttaccttgtgaaccatggtgtggatgaggattttatgaagcaagtgtttgagcacagtgcaaagctcttctc |
150 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||| | |||||||||||||||| ||| ||||| ||||||||| | || || |
|
|
| T |
41480799 |
tataggcatgtgttgagtatggtttcttttaccttgtgaaccacggtgtggacaaagattttatgaagcaagcgttcgagcagagtgcaaagtttttttc |
41480898 |
T |
 |
| Q |
151 |
acttcc |
156 |
Q |
| |
|
|||||| |
|
|
| T |
41480899 |
acttcc |
41480904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University