View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19062_low_19 (Length: 327)
Name: NF19062_low_19
Description: NF19062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19062_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 19 - 319
Target Start/End: Original strand, 36684620 - 36684920
Alignment:
| Q |
19 |
gattgtaagcaatacaaatatgctatttagatagagtcaacaaggtaatgagatgaagggtaacacttttttatacaacccaaatcctttaccacaattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36684620 |
gattgtaagcaatacaaatatgctatttagatagagtcaacaaggtaatgagatgaagggtaacacttttttatacaacccaaatcctttaccacaattt |
36684719 |
T |
|
| Q |
119 |
cattgggaagctagatggctttggactgttcgattaagagagaaattttttaagattatgagagatcctctataatctaacggggtcttctgcatcgtaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36684720 |
cattgggaagctagatggctttggactgttcgattaagagagaaaatttttaagattatgagagatcctctataatctaacggggtcttctgcatcgtaa |
36684819 |
T |
|
| Q |
219 |
agccaaatgtagagaatttaatttgtgttttatagacttttttaaatcttcttttaatatcgatctaaaccatcacggctcattaagttagtccctttgc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36684820 |
agccaaatgtagagaatttaatttgtgttttatagacttttttaaatcttcttttaatatcgatctaaactatcacggctcattaagttagtccctttgc |
36684919 |
T |
|
| Q |
319 |
t |
319 |
Q |
| |
|
| |
|
|
| T |
36684920 |
t |
36684920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University