View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19063_high_15 (Length: 350)
Name: NF19063_high_15
Description: NF19063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19063_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 218
Target Start/End: Complemental strand, 37719272 - 37719067
Alignment:
| Q |
13 |
aatataccaaagaccgaaaccgatggatcagcttatgccacacgaaggaaaggacaagttgaagaagaaaagtaaggtggcttgactaactgcacatatc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37719272 |
aatataccaaagaccgaaaccgatggatcagcttatgccacacgaagaaaaggacaagttgaagaagaaaagtaaggtggcttgactaactgcacatatc |
37719173 |
T |
|
| Q |
113 |
aacaacgaatggctaaaatttctacactgacttgtatatgacgacccattgaccattacaagatcacattaaattcaagtatgaatattgaacactccct |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37719172 |
aacaacgaatggctaagatttctacactgacttgtatatgacgacccattgaccattacaagatcacattaaattcaagtatgaatattgaatactccct |
37719073 |
T |
|
| Q |
213 |
ctaatt |
218 |
Q |
| |
|
|||||| |
|
|
| T |
37719072 |
ctaatt |
37719067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 273 - 350
Target Start/End: Complemental strand, 37719054 - 37718977
Alignment:
| Q |
273 |
ttaagttttatgcccctttcattctacaatgatcactttgtaaatttatttgtctcattttatatgttgttatgagtt |
350 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37719054 |
ttaagttttatgcccctttcatcctacaatgatcactttgtaaatttatttgtcccattttatatgttgttatgagtt |
37718977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University