View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19063_high_27 (Length: 241)
Name: NF19063_high_27
Description: NF19063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19063_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 35495725 - 35495943
Alignment:
| Q |
18 |
ttgggaagctcatgcgaaacgagggggaggagttttttggaaacgccaccggcgagaaccactacttggaaatccatccaaacagaaagggttttgggtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35495725 |
ttgggaagctcatgcgaaacgagggggaggagttttttggaaacgccaccggcgagaaccactacttggaaatccatccaaacggaaagggttttgggtt |
35495824 |
T |
 |
| Q |
118 |
tgaggaagagagttttcttactcccaaatcaaaatctcggattcaacacaaaattgatactaaacact--acacagttcacaattttgcttcctgcacct |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35495825 |
tgaggaagagagttttcttactcacaaatcaaaatctcggattcaacacaaaattgatactaaacactacacacagttcacaattttgcttcctgcacct |
35495924 |
T |
 |
| Q |
216 |
gcagccaaatttacttttt |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
35495925 |
gcagccaaatttacttttt |
35495943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University