View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19063_low_15 (Length: 378)
Name: NF19063_low_15
Description: NF19063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19063_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 66 - 288
Target Start/End: Complemental strand, 35496231 - 35496015
Alignment:
| Q |
66 |
ttattgagtagaatttatatggacaccacaacttgaaaataaatcctacttaaaattgtacccacatgaatgtcactctctcnnnnnnnggtacaaaatt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
35496231 |
ttattgagtagaatttatatggacaccacaacttaaaaataaatcctacgtaaaattgtatccacatgaatgtcactctcttttttattggtacaaaatt |
35496132 |
T |
|
| Q |
166 |
tcactctacaagacagtgaatgttaagagagcactagataaagtagtgtttattgcatttctttactaattaaaacaaaaattcttaaacaatgggatac |
265 |
Q |
| |
|
|||||||||| |||||||||| ||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35496131 |
tcactctaca------tgaatgttaaaagagcactaaataaagtagtgtttatagcatttctttactaattcaaacaaaaattcttaaacaatgggatac |
35496038 |
T |
|
| Q |
266 |
cttggcccttaatcggggcgggt |
288 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35496037 |
cttggcccttaatcggggcgggt |
35496015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University