View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19063_low_30 (Length: 239)
Name: NF19063_low_30
Description: NF19063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19063_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 223
Target Start/End: Complemental strand, 19052893 - 19052686
Alignment:
| Q |
16 |
aaaatcatttagagtgttataatatgtcatttgatatctggaaaaatttagtcaaaatacaagagtaaaacaaatacttgtcttattacaaaccaagttc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19052893 |
aaaatcatttagagtgttataatatgtcacttgatatctggaaaaatttagtcaaaatacaagagtaaaacaaatacttgtcttattacaaaccaagttc |
19052794 |
T |
|
| Q |
116 |
ttcgaggctaaaaagttaccgtacaaccaagcaacctctcgagacaggtagcttctgtttatttgaaacttagtgagctctgaaactaatccattcgact |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19052793 |
ttcgaggctaaaatgttaccgtacaaccaagcaacctctcgagacaggtagcttctgtttatttgaaacttagtgagctctgaaactaatccattcgact |
19052694 |
T |
|
| Q |
216 |
atattcat |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
19052693 |
atattcat |
19052686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University