View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19063_low_31 (Length: 234)
Name: NF19063_low_31
Description: NF19063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19063_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 8817577 - 8817374
Alignment:
| Q |
18 |
atttacaccatcagcaggttcagaactatt-ggactcaaataacatggttcattataaaacatcctcattctcaacctttctgttggttcattcctcttt |
116 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8817577 |
atttacacaatcagcaggttcagaactatttggactcaaataacatggttcattataaaacatcctcattctcaacctttctattggttcattcctcttt |
8817478 |
T |
 |
| Q |
117 |
tctggtctcattgctggttatctttatgatcttgaagccactagtgtgccactaagtgaaaattcttgcatcggagcacattgtttcatgcttgtgtatt |
216 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8817477 |
tctgatctcattgctggttatctttatgatcttgaagccactagtgtgccacgaagtgaaaattcttgcatcggagcacattgtttcatgcttgtgtatt |
8817378 |
T |
 |
| Q |
217 |
tgat |
220 |
Q |
| |
|
|||| |
|
|
| T |
8817377 |
tgat |
8817374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 22 - 220
Target Start/End: Complemental strand, 8819177 - 8818978
Alignment:
| Q |
22 |
acaccatcagcaggttcagaactatt-ggactcaaataacatggttcattataaaacatcctcattctcaacctttctgttggttcattcctcttttctg |
120 |
Q |
| |
|
|||||| |||||| |||||||||||| || |||||||| |||||| |||||| ||||||||||||||||||||| || | ||||||||| ||||||||| |
|
|
| T |
8819177 |
acaccagcagcagcttcagaactatttggtctcaaatactatggtttattatacaacatcctcattctcaaccttcctatcggttcattcatcttttctg |
8819078 |
T |
 |
| Q |
121 |
gtctcattgctggttatctttatgatcttgaagccactagtgtgccactaagtgaaaattcttgcatcggagcacattgtttcatgcttgtgtatttgat |
220 |
Q |
| |
|
|||||||||| || || ||||||||| |||||||||| ||||||||| | | | ||| |||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
8819077 |
gtctcattgccggctacctttatgatattgaagccaccagtgtgccaggaggcggaaacacttgcagtggagcacattgtttcatgcttgtgtatgtgat |
8818978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University