View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19064_high_3 (Length: 385)
Name: NF19064_high_3
Description: NF19064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19064_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 96 - 371
Target Start/End: Original strand, 38723459 - 38723735
Alignment:
| Q |
96 |
tgaatacctctccttttttactcgtgtgtgtaaatatgaataccttccgtgtctctcttgaggctacatgtgtcgcgctctagtgcnnnnnnnnnnnnnn |
195 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38723459 |
tgaatacctctccttttttacttgtgtgtataaatatgaataccttccgtgtctctcttgaggctacatgtgtcgcgctctagtg----taaaaaaaaaa |
38723554 |
T |
|
| Q |
196 |
nnntgaagcctgcaaattgtctaatttggcaacnnnnnnngaggtatttcgattgatctcaat------gtatggtaccttattcttttcttttttatca |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
38723555 |
aaatgaagcctgcaaattgtctaatttggcaacaaaaaaagaggtatttcgattcatctcaattgaaatgtatggtacctt-ttcttttcttttttatca |
38723653 |
T |
|
| Q |
290 |
aacgtcaaaacactcacatccattcatttaagtgtttaagccactaccggatatacacattatttatttttactagtataat |
371 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38723654 |
aacgtcaaaacactcacatccattcattaaagtgtttaagccactaccggatatacacattatttatttgtactagtataat |
38723735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 47 - 78
Target Start/End: Original strand, 38723409 - 38723440
Alignment:
| Q |
47 |
taaacaacatcaatgcctagtctttttattat |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38723409 |
taaacaacatcaatgcctagtctttttattat |
38723440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University