View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19064_high_7 (Length: 305)
Name: NF19064_high_7
Description: NF19064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19064_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 14 - 288
Target Start/End: Complemental strand, 25813980 - 25813706
Alignment:
| Q |
14 |
atatgtctgcatttgtagagtttcttttgaaaccacaactcagttaatgatgttcttcccttgccatgattctcaacattaccagaaaagatgtttagta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25813980 |
atatgtctgcatttgtagagtttcttttgaaaccacaactcagttaatgatgttcttcccttgccatgattctcaacattaccagaaaagatgtttagta |
25813881 |
T |
|
| Q |
114 |
tcgctagcgtatactttgctccatcgtgaccttgttgtaaggccatttctagaaaatttctagcagaatcatagtttgaaatttgatagcaaatatctag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25813880 |
tcgctagcgtatactttgctccatcgtgaccttgttgtaaggccatttctagaaaatttctagtagaatcatagtttgaaatttgatagcaaatatctag |
25813781 |
T |
|
| Q |
214 |
gatacccattcgaaagcaatactctggatttctactagattctaacaattggtaaaaagaatccctatttccatc |
288 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25813780 |
gatacccattctaaagcaatactctggatttctactagattctaacaattggtaaagagaatccctatttccatc |
25813706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University