View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19064_low_8 (Length: 240)
Name: NF19064_low_8
Description: NF19064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19064_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 93 - 142
Target Start/End: Original strand, 8230877 - 8230926
Alignment:
| Q |
93 |
tttggccaatgaattgcattcatctcattattgtgatagggcaagacttt |
142 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
8230877 |
tttggccaatcaattgcactcctctcattattgtgatagggcaagacttt |
8230926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 8230947 - 8230996
Alignment:
| Q |
139 |
ctttcccacttggtaatttacgaacaaaaacgtcttcgaaaacattttat |
188 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| |||||||||| |
|
|
| T |
8230947 |
ctttcccacttggtaatttaggaacaaaaacctcttcgataacattttat |
8230996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University