View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19065_high_29 (Length: 238)
Name: NF19065_high_29
Description: NF19065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19065_high_29 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 52784048 - 52784289
Alignment:
| Q |
1 |
aatatgtgttatattattaaagggagaagctgtgtgtaattcggtccttattggaaatcacataaggcgtaagtgatatccaataagaaccaatcacatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52784048 |
aatatgtgttatattattaaagggagaagctgtgtgtaattcggtccttattggagatcacataaggcgtaagtgatatccgataagaaccaatcacatt |
52784147 |
T |
|
| Q |
101 |
taacat----catcattttgtgaatatgcttttcgcaacaacgggcattttcaaacaaaaaatgacaaaaggtgcataaaaatgtcagcatataaccaaa |
196 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52784148 |
taacatgcatcatcattttgtgaagatgcttttcgcgacaacgggcattttcaaacaaaaaatgacaaaaggttcataaaaatgtcagcatataaccaaa |
52784247 |
T |
|
| Q |
197 |
taaattctcacttgccacacaaagtagtaaaatgcccatgtt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52784248 |
taaattctcacttgccacacaaagtagtaaaatgcccatgtt |
52784289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University