View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19065_high_32 (Length: 237)
Name: NF19065_high_32
Description: NF19065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19065_high_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 22 - 223
Target Start/End: Complemental strand, 7906906 - 7906706
Alignment:
| Q |
22 |
acttcccaaatttcaattgtcaaaagttcttttatctcttaattattactcttttccnnnnnnnntccactttctcaatttgtttagtacttcttctgct |
121 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906906 |
acttcccaaatttcaattgtcaaaagttcatttatctcttaattattactcttttccaaaaaaa-tccactttctcaatttgtttagtacttcttctgct |
7906808 |
T |
|
| Q |
122 |
ttgttgcatctttgtctcaaatatctttggcaaaaatctttgttcagtttttgctggtatggaagaagctcaagacatggttgctgcagctcaacacatt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906807 |
ttgttgcatctttgtctcaaatatctttggcaaaaatctttgttcagtttttgctggtatggaagaagctcaagacatggttgctgcagctcaacacatt |
7906708 |
T |
|
| Q |
222 |
at |
223 |
Q |
| |
|
|| |
|
|
| T |
7906707 |
at |
7906706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University