View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19065_low_28 (Length: 245)
Name: NF19065_low_28
Description: NF19065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19065_low_28 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 52784553 - 52784317
Alignment:
| Q |
16 |
tcatctacacaagcagattttgtattttgcaacgtagtgtagaataatacagttgattaatttctagcttattattgcctttatctagctaaattaactc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52784553 |
tcatctacacaagcagattttgtattttgcaacgtagtgtagaataatacagatgattgatttctagcttattattgcctttatctagctaaattaactc |
52784454 |
T |
|
| Q |
116 |
ctttatagtacccaaagaggaaaagaaaagtcacaaatattcaattaacctcctctccttctctagctgatacatc-------gcactttaaaaaattta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52784453 |
ctttatagtacccaaagaggaaaagaaaagtcacaaatattcaattaacctcctctccttctctagctgatacatctaatatggcactttaaaaaattta |
52784354 |
T |
|
| Q |
209 |
cgatgataaatgcaaaaattataaaccagcgtaatgc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52784353 |
cgatgataaatgcaaaaattataaaccagcgtaatgc |
52784317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University