View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19065_low_29 (Length: 245)
Name: NF19065_low_29
Description: NF19065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19065_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 21 - 229
Target Start/End: Complemental strand, 45502808 - 45502602
Alignment:
| Q |
21 |
aattcacgaaatacttcaaaaatgaagggtttatttatcgcaagattgagtgaacttattatttgtaagttgggaatgatcgatattccttcaaaagtca |
120 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45502808 |
aattcactaaatacttcaaaaatgaagggtttattt--cgcaagattgagtgaacttattatttgtaagttgggaatgatcgatattccttcaaaagtca |
45502711 |
T |
 |
| Q |
121 |
gtcgattagtgtgcaaatagtattttttgtatttggtttgagccccgataaacaaagcctatcaacttagtttatctttatttaagcaattttttagcaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45502710 |
gtcgattagtgtgcaaatagtattttttgtatttggtttgagccccgataaacaaagcctatcaacttagtttatctttttttaagcaattttttagcaa |
45502611 |
T |
 |
| Q |
221 |
tgtagctat |
229 |
Q |
| |
|
|||| |||| |
|
|
| T |
45502610 |
tgtaactat |
45502602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University