View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19065_low_36 (Length: 226)
Name: NF19065_low_36
Description: NF19065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19065_low_36 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 10970343 - 10970567
Alignment:
| Q |
7 |
gcttgcctgatgtttttaaaacggaaaactaacaaaaattgtgaaaattgagatgatgtttgcccaaaagttttacatcagataacaatttcttaggca- |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10970343 |
gcttgcctgatgtttttaaaacggaaaactaacaaaaattgtgaaaattgagatgatgtttgcccaaaagttttacatcagataacaatttcttaggcaa |
10970442 |
T |
 |
| Q |
106 |
---tcattttaaatctg-nnnnnnnctttatgcttatcaacatttcaatatattttaaaagattttgcaatatttcaaagtaacgtagcaattcacctca |
201 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10970443 |
acgtcattttaaatctgttttttttctttatgcttatcaacatttcaatatattttaaaagattttgcaatatttcaaagtaacttagcaattcacctca |
10970542 |
T |
 |
| Q |
202 |
attttgctcctgaagcctaaagaat |
226 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
10970543 |
attttgctcctgaagcctaaagaat |
10970567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University