View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19065_low_37 (Length: 220)
Name: NF19065_low_37
Description: NF19065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19065_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 41 - 206
Target Start/End: Complemental strand, 5416752 - 5416569
Alignment:
| Q |
41 |
gacaatccaaaccagatcaaaacattcaaccctaatacatgatggaattgtgg------------------aagcatttgactccgttacgacctgctcc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5416752 |
gacaatccaaaccagatcaaaacattcaaccctaatacatgatggaattgtggtcacttttggacttgtggaagcatttgactccgttacgacctgctcc |
5416653 |
T |
 |
| Q |
123 |
tcctaaggaaagggacaatcttggtgagctcaatcttagggagctcatcacacgttggcttgtttgtgtgcctgatgaaattgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5416652 |
tcctaaggaaagggacaatcttggtgagctcaatcttagggagctcatcacacgttggcttgtttgtgtgcctgatgaaattgt |
5416569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University