View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19066_low_15 (Length: 209)
Name: NF19066_low_15
Description: NF19066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19066_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 26 - 202
Target Start/End: Complemental strand, 31954251 - 31954075
Alignment:
| Q |
26 |
gcacatcttgctacaggtgtggtggggttggtcacatagcaagagattgcgctactcctagtagcggaggtggtggaggcggcgcttgctataagtgcgg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31954251 |
gcacatcttgctacaggtgtggtggggttggtcacatagcaagagattgcgctactcctagtagcggaggtggtggaggcggcgcttgctataagtgcgg |
31954152 |
T |
|
| Q |
126 |
tgaggtgggtcacatagctagggattgcagcaatgaagggggaaggtttgatggtggcaatggaaggtatgatgatg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31954151 |
tgaggtgggtcacatagctagggattgcagcaatgaaggaggaaggtttgatggtggcaatggaaggtatgatgatg |
31954075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University