View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19067_low_17 (Length: 287)
Name: NF19067_low_17
Description: NF19067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19067_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 116 - 275
Target Start/End: Original strand, 9617526 - 9617684
Alignment:
| Q |
116 |
gatctccgtctaacgttagtattaggcttcccccctttgccgcctaccattttctcctcctgcgaaacacttgtgattctccatttgtggagtttacgtg |
215 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9617526 |
gatctccgtctagcgttagtattaggcttctcccctttgccgcctaccattttctcctcctgcgaaacacttgtgattctccattt-tggagtttacgtg |
9617624 |
T |
 |
| Q |
216 |
tagccactatgactcattgctctgttcatcttcctttacttaagaccctggatctgatga |
275 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9617625 |
tagccactatgactcattgttctgttcatcttcctttacttaagaccctggatatgatga |
9617684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University