View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19068_high_9 (Length: 242)
Name: NF19068_high_9
Description: NF19068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19068_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 44114004 - 44113813
Alignment:
| Q |
20 |
ctcactcagacccaacatcactaaccattcttcatcaagatcaagttggaggtcttgaagtttttgcagataataaatgggtggctgttcgccctagacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44114004 |
ctcactcagacccaacatcactaaccattcttcatcaagatcaagttggaggtcttgaagtttttgcagataataaatgggtggctgttcgccctagacc |
44113905 |
T |
|
| Q |
120 |
tgaagccctagtcattaacataggtgacactttcatggtatgtaaactactcttttcttcttctttttcttgatatgcaataatgtcatgcg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44113904 |
tgaagccctagtcattaacataggtgacactttcatggtatgtaaactactcttttcttcttctttttcttgatatgcaataatatcatgcg |
44113813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 85
Target Start/End: Original strand, 40553830 - 40553866
Alignment:
| Q |
49 |
cttcatcaagatcaagttggaggtcttgaagtttttg |
85 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40553830 |
cttcatcaagatcaagttggaggtcttcaagtttttg |
40553866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 54 - 165
Target Start/End: Complemental strand, 39315225 - 39315114
Alignment:
| Q |
54 |
tcaagatcaagttggaggtcttgaagtttttgcagataataaatgggtggctgttcgccctagacctgaagccctagtcattaacataggtgacactttc |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || || |||||| | ||||| | ||| | ||||| || | ||||| |||||||||||||| ||| |
|
|
| T |
39315225 |
tcaagatcaagttggaggtcttgaagtttttgctgacaacaaatggcttgctgtgcccccaaagcctgatacctttgtcatcaacataggtgacaccttc |
39315126 |
T |
|
| Q |
154 |
atggtatgtaaa |
165 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
39315125 |
atggtaagtaaa |
39315114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 99
Target Start/End: Complemental strand, 39306259 - 39306188
Alignment:
| Q |
28 |
gacccaacatcactaaccattcttcatcaagatcaagttggaggtcttgaagtttttgcagataataaatgg |
99 |
Q |
| |
|
|||||||| ||| | ||||||||| ||||||||||||||||||||| |||| ||||| ||||| |||||| |
|
|
| T |
39306259 |
gacccaacctcagtcaccattctttttcaagatcaagttggaggtctagaagcttttgtggataacaaatgg |
39306188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University