View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19068_low_7 (Length: 296)
Name: NF19068_low_7
Description: NF19068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19068_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 9 - 279
Target Start/End: Complemental strand, 30955873 - 30955596
Alignment:
| Q |
9 |
aatatagaggagtggtttctcactaactgtaaaaactgtaaaactatatgaacaagtaggatatattgtgaagctaacttttcaaatatagaatggtggc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30955873 |
aatatagaggagtggtttctcactaactgtaaaaactgtatagctatatgaacaagtaggatatattgtgaagcaaacttttcaaatatagaatggtggc |
30955774 |
T |
|
| Q |
109 |
cttatggattgtctaagggcatagttttggggtagtttatttctcttatgtgtaaccttattgctgcttcaaaataaaatgtgttgagtacaattgtata |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30955773 |
cttatggattgtctaagggcatagttttggggtagttaatttctcttatgtgtaaccttattgctgcttcaaaataaaatgtgttgagtacaattgtata |
30955674 |
T |
|
| Q |
209 |
ctgt-------tttggagaagggttaagattgtgtcttgtagatggtttttggttagagctaaggtattggtcgttgc |
279 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30955673 |
ctgttttgtgttttggagaagggttaagattgtgtcttgtagatggtttttggttagagctaaggtattggtcgttgc |
30955596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University