View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19069_high_19 (Length: 326)
Name: NF19069_high_19
Description: NF19069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19069_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 12 - 309
Target Start/End: Original strand, 42114001 - 42114298
Alignment:
| Q |
12 |
caaaggattaaggattcgaatctacgcattgggttctgtcgttttggtggctcttcctcttcaggttgtatcgttggccttcaccgttctatggagtcct |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42114001 |
caaaggattaaggattcgaatctacgcattgggttctgtcgttttggtggctcttcctcttcaggttgtgtcgttggccttcaccgttctatggagtcct |
42114100 |
T |
 |
| Q |
112 |
gaagatgatatttacggcgtcgtttcattggtggtgtttttctgtgcttttttctgtgctgttgctggtgagggtattttggtaattaagcctgtttcgg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42114101 |
gaagatgatatttacggcgtcgtttcattggtggtgtttttctgtgcttttttctgtgctgttgctggtgagggtattttggtaattaagcctgtttctg |
42114200 |
T |
 |
| Q |
212 |
atgcgttggctgctggtggaaactgttgtgtgtggccgacacgtcgtcaagattcgttgccggcgaaggaagagaagatggaggaggagacagttgct |
309 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42114201 |
atgcgttggctgctggtggaaactgttgtatgtggccgacacgtcgtcaagattcgttgccggcgaaggaagagaagatggaggaggagacagttgct |
42114298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University