View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19069_high_22 (Length: 302)
Name: NF19069_high_22
Description: NF19069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19069_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 25 - 291
Target Start/End: Original strand, 41986197 - 41986464
Alignment:
| Q |
25 |
atgcacagttgtgactcggtcggttctggttcttcttccatgatgaaggaggttcccaa-tggacgacatgggaaaatttgttgaagtcaagcacgtaag |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
41986197 |
atgcacagttgtgactcggtcggttctggttcttcttccatgatgaaggaggttcccaaatggacgacatgagagaatttgttgaagtcaagcacgtaag |
41986296 |
T |
|
| Q |
124 |
gaaaatcataagggcaaggatactcacatgggcggaggggatggaagagttgtgtttcgccacatgaattttgggtaattctaatcaaccagggacggag |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41986297 |
gaaaatcataagggcaaggatactcacatgggcggagtggatggaagagttgtgtttccccacatgaattttgggtaattctaatcaaccagggacggag |
41986396 |
T |
|
| Q |
224 |
attttgttgttgcgttggtggtttgatgagtaagagactgtgttttgagaggaaataggatgatgatg |
291 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41986397 |
attttgttgttgtggtggtggtttgatgagtaagagactgtgttttgagaggaaataggatgatgatg |
41986464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 156 - 223
Target Start/End: Complemental strand, 44688249 - 44688182
Alignment:
| Q |
156 |
cggaggggatggaagagttgtgtttcgccacatgaattttgggtaattctaatcaaccagggacggag |
223 |
Q |
| |
|
||||| || ||||||||||||||||| || | ||| |||| |||||||||||||||||| |||||||| |
|
|
| T |
44688249 |
cggagtgggtggaagagttgtgtttctccgcgtgagtttttggtaattctaatcaaccaaggacggag |
44688182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University