View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19069_high_39 (Length: 236)
Name: NF19069_high_39
Description: NF19069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19069_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 16 - 169
Target Start/End: Original strand, 14546264 - 14546419
Alignment:
| Q |
16 |
aaatcatgacatactaacaatgtgttgaatattgcatgacttcttgtgggtttatc-tttttagtttctatgtaagtcaaggaaacatattttgcagtga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
14546264 |
aaatcatgacatactaacaatgtgttgaatattgcatgacttcttgtgggtttatcttttttagtttctatgcaagtcaaggaaacaaattttgcagtga |
14546363 |
T |
 |
| Q |
115 |
a-nnnnnnnnncaaaatgctattgttcatatttggtatcaatgtcatagtgacttt |
169 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14546364 |
attttttttttcaaaatgctattgttcatatttggtatcaatgtcataatgacttt |
14546419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 153 - 236
Target Start/End: Original strand, 14546433 - 14546516
Alignment:
| Q |
153 |
aatgtcatagtgactttggttgtatcacggtgagccattgtgattttgcaaaatcatagtggtttgacatgatatcaaacatac |
236 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14546433 |
aatgtcataatgactttggttgtatcacggtgagccattgtgattttgcaaaatcatagtggtttgacatgatatcaaacatac |
14546516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 205
Target Start/End: Complemental strand, 48586919 - 48586888
Alignment:
| Q |
174 |
gtatcacggtgagccattgtgattttgcaaaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48586919 |
gtatcacggtgagccattgtgattttgcaaaa |
48586888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University