View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19069_high_45 (Length: 210)

Name: NF19069_high_45
Description: NF19069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19069_high_45
NF19069_high_45
[»] chr7 (1 HSPs)
chr7 (13-210)||(28122342-28122539)


Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 210
Target Start/End: Complemental strand, 28122539 - 28122342
Alignment:
13 acagatgaagagccaatttgtctatgagtaaggtcacatgccactgattgaatcccagaagtggttgatgttggggcatgatgatgagcagctaagtatt 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
28122539 acagatgaagagccaatttgtctatgagtaaggtcacatgccactgattgaatcccagcagtggttgatgttggggcatgatgatgagcagctaagtatt 28122440  T
113 gacgtggatcaatactggacctctgttgttgcatggagaatgaaggttgtcccattgagtcgaaaagtgtagacatatcataggtgaccggcatggtt 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28122439 gacgtggatcaatactggacctctgttgttgcatggagaatgaaggttgtcccattgagtcgaaaagtgtagacatatcataggtgaccggcatggtt 28122342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University