View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19069_low_10 (Length: 406)
Name: NF19069_low_10
Description: NF19069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19069_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 1e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 139 - 382
Target Start/End: Complemental strand, 12723937 - 12723699
Alignment:
| Q |
139 |
cttgtgagttctcaatctttaaatctatgatttactttcttgtgggttctcaatgttcaaatttcaattgcgtgatataataatgtagacataaacagtg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12723937 |
cttgtgagttctcaatctttaaatctatgatttactttcttgtgggctctcaatgttcaaatttcaattgcgtgatataataatgcagacataaacagtg |
12723838 |
T |
|
| Q |
239 |
gcggttcttggtgggaacccatggtagccacggctccaccccactaaaaagataaataannnnnnnatagaggaaattaccaaaatacctctgatatatt |
338 |
Q |
| |
|
|| ||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||| |||||||||||||||||||||| |
|
|
| T |
12723837 |
gcagtttttggtgggaacccatggtagccacggctccaccccactataaagataaataatttttttatagagaaaatgaccaaaatacctctgatatatt |
12723738 |
T |
|
| Q |
339 |
tagatattttctctctatcaacctagtctcacacgacaccccat |
382 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
12723737 |
tagatattttctctctgtc-----agtctcacacgacaccccat |
12723699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 234 - 354
Target Start/End: Complemental strand, 53029972 - 53029856
Alignment:
| Q |
234 |
cagtggcggttcttggtgggaacccatggtagccacggctccaccccactaaaaagataaataannnnnnnatagaggaaattaccaaaatacctctgat |
333 |
Q |
| |
|
||||||||||||||||||||| | |||||| |||| |||||||||| |||||||| |||||||| ||||||||||| ||||||||||| || || |
|
|
| T |
53029972 |
cagtggcggttcttggtgggagctcatggtggccatggctccaccc-actaaaaa-ataaataatttat--atagaggaaatgaccaaaatacccctaat |
53029877 |
T |
|
| Q |
334 |
atatttagatattttctctct |
354 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
53029876 |
atatttggatattttctctct |
53029856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University