View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19069_low_25 (Length: 296)
Name: NF19069_low_25
Description: NF19069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19069_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 54816454 - 54816179
Alignment:
| Q |
1 |
caaacaagtatggttatgaacagtgttatgtaatcacctctgaagtagtgtttatttcatgtcattaataaaggtctttggaactctaatcagatcaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54816454 |
caaacaagtatggttatgaacagtgttatgtaatcacctctgaagtagtgtttatttcatgtcatgaataaaggtctttggaactctaatcagatcaatt |
54816355 |
T |
 |
| Q |
101 |
tagtttggatttctatatatatcatcatgaatttgcttgttttgtacatatagactaaagatgtgaactttagtaaagttggtattttatattcaaattg |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54816354 |
tagttttgatttctatatatatcatcatgtatttgcttgttttgtacatatagactgaagatgtgaactttagtaaagttggtattttatattcaaattg |
54816255 |
T |
 |
| Q |
201 |
tgtttgttcttgctgnnnnnnngaaaattcacaattcagtatgtgttattttacagcattgtttatttgtttactt |
276 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54816254 |
tgtttgttcttactgtttttttgaaaattcacaattcagtatgtgttattttacagcattgtttatttgtttactt |
54816179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University