View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19069_low_34 (Length: 253)
Name: NF19069_low_34
Description: NF19069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19069_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 5 - 227
Target Start/End: Complemental strand, 18342569 - 18342352
Alignment:
| Q |
5 |
attaagtttaagattcccaagggaagtgaaatatcttgagtagttgtatttgattgggttcttgctaaaaaagacttggcagactatgtcgtttacggtc |
104 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
18342569 |
attaagtttaagattctcaagggaagtgaaatatcttgagta-----attcgattgggttcttgctagaaaagacttggtagactatgtcgtttacggtc |
18342475 |
T |
|
| Q |
105 |
tgcctctcttacctgggaagtcaaccatactcttcattgtattttactaggtataagtaaggtttatgtgaggaaagaatgattaagatactttgatgtt |
204 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18342474 |
tgcctctcttacctggaaaatcaaccatactcttcattgtattttactaggtataagtaagctttatgtgaggaaagaatgattaagatactttgatgtt |
18342375 |
T |
|
| Q |
205 |
atttgtggtaactggcactcaaa |
227 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
18342374 |
attcgtggtaactggcactcaaa |
18342352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 5 - 231
Target Start/End: Complemental strand, 16342102 - 16341874
Alignment:
| Q |
5 |
attaagtttaagattcccaagggaagtgaaatatcttgagtagttgtatttgattgggttcttgctaaaaaagacttggcagactatgtcgtttacggtc |
104 |
Q |
| |
|
|||||||||| ||| ||||| | ||||| |||| |||||||||||||||| | ||||||||| || | |||||||||| ||||||||||||||||||| |
|
|
| T |
16342102 |
attaagtttatgatccccaaagaaagtggaataccttgagtagttgtattcggttgggttctggcaaggaaagacttggtggactatgtcgtttacggtc |
16342003 |
T |
|
| Q |
105 |
tgcctctcttacctgggaagtcaaccat--actcttcattgtattttactaggtataagtaaggtttatgtgaggaaagaatgattaagatactttgatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||| ||||||||| |||| || ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16342002 |
tgcctctcttacctgggaagtcaaccatacactattcattctattttactgggtaaaaataaggtttatgtgaggaaagaatgattaagatactttgagg |
16341903 |
T |
|
| Q |
203 |
ttatttgtggtaactggcactcaaactag |
231 |
Q |
| |
|
|||| ||||||| | |||||||||||| |
|
|
| T |
16341902 |
ttatagatggtaaccgacactcaaactag |
16341874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University