View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1906_high_10 (Length: 214)
Name: NF1906_high_10
Description: NF1906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1906_high_10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 214
Target Start/End: Original strand, 3704972 - 3705172
Alignment:
| Q |
14 |
atgaacggtcaaatttaatgttcaatttgatgcactatcaataggactttggcggagaaaaagacacaattttttgtggtgtgttcgatggtcatggtcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3704972 |
atgaacggtcaaatttaatgttcaatttgatgcactatcaataggactttggcggagaaaaagacacaattttttgtggtgtgttcgatggtcatggtcc |
3705071 |
T |
|
| Q |
114 |
tctaggacacaaatttgcacaatgtatacgtgacaatctaccttctaaactctctacaacaatcaaaatgtcacaacaaaatgtcgatggtgctaatgct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3705072 |
tctaggacacaaatttgcacaatgtatacgtgacaatctaccttctaaactctctacaacaatcaaaatgtcacaacaaaatgtcgatggtgctaatgct |
3705171 |
T |
|
| Q |
214 |
a |
214 |
Q |
| |
|
| |
|
|
| T |
3705172 |
a |
3705172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 88 - 191
Target Start/End: Complemental strand, 26034634 - 26034531
Alignment:
| Q |
88 |
tgtggtgtgttcgatggtcatggtcctctaggacacaaatttgcacaatgtatacgtgacaatctaccttctaaactctctacaacaatcaaaatgtcac |
187 |
Q |
| |
|
||||| ||||| || ||||||||||||||||| |||||| | | |||| ||| || ||||||||||| || | ||| ||| || ||||||||||| ||| |
|
|
| T |
26034634 |
tgtggcgtgtttgacggtcatggtcctctaggccacaaagtgtcgcaatttattcgcgacaatctaccctcgacactatctgcagcaatcaaaatggcac |
26034535 |
T |
|
| Q |
188 |
aaca |
191 |
Q |
| |
|
|||| |
|
|
| T |
26034534 |
aaca |
26034531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University