View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1906_low_14 (Length: 240)
Name: NF1906_low_14
Description: NF1906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1906_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 7 - 141
Target Start/End: Complemental strand, 43138797 - 43138663
Alignment:
| Q |
7 |
agatcaacccctataaagctccctcgttttttatggtgaaaatatggttgatgaagcagtgttagatgccttgcaaatctggctcatgcatgatcgcatt |
106 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43138797 |
agatcaaccccgataaagctccctcgttttttatggtgaaaatatggtcaatgaagcagcgttagatgccttgcaaatctggctcatgcatgatcgcatt |
43138698 |
T |
|
| Q |
107 |
ttgagcgtttgcagcttatggttgtgccgcctcct |
141 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
43138697 |
ttgagtgtttgcagcttatggttgtgctgcctcct |
43138663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 142 - 229
Target Start/End: Complemental strand, 43135583 - 43135492
Alignment:
| Q |
142 |
ctaaatcacatctaagatgagaatttcaaaggagttatattttctc----gtcttgttagttgttatgccttgagacaaattgcaatgatga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43135583 |
ctaaatcacatctaagatgagaatttcaaacgagttttattttctctctcgtcttgttagttgttatgccttgagacaaattgcaatgatga |
43135492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University