View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1906_low_19 (Length: 202)
Name: NF1906_low_19
Description: NF1906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1906_low_19 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 59 - 202
Target Start/End: Complemental strand, 55179248 - 55179100
Alignment:
| Q |
59 |
aactaataggtttggttaatttggtagtatataatattatattatatt-----gtatcacattcatgcacgtgtgtcttgtttttatattatagggaacg |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55179248 |
aactaataggtttggttaatttggtagtatataatattatattatattatattgtatcacattcatgcacgtgtgtcttgtttttatattatagggaacg |
55179149 |
T |
 |
| Q |
154 |
tgttttagttttctttttgctctcaaagaaaatctactatagcaaattt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55179148 |
tgttttagttttctttttgctctcaaagaaaatctactatagcaaattt |
55179100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 48
Target Start/End: Complemental strand, 55179262 - 55179231
Alignment:
| Q |
17 |
cacagataataaacaactaataggtttggtta |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55179262 |
cacagataataaacaactaataggtttggtta |
55179231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University