View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1906_low_7 (Length: 338)
Name: NF1906_low_7
Description: NF1906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1906_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 11 - 284
Target Start/End: Original strand, 5779905 - 5780178
Alignment:
| Q |
11 |
cacagatcttgaacaactgattcttagattgcacattctgcaaaggtacaatatccataacagaaattccaacgtaactgaaaactgaacacaacatcat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5779905 |
cacagatcttgaacaactgattcttagattgcacattctgcaaaggtacaatatccataacagaaattccaacgtaactgaaaactgaacacaacatcat |
5780004 |
T |
 |
| Q |
111 |
gtgacacatggtgagaaaaaccgggaacttgtaaccatagttgcttaacaagtacttgttcattagaagaacaccaatgtttgaagtgtaccatgatatt |
210 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5780005 |
gtgacacatggtgaggaaaaccgggaacttgtaaccatagctgcttaacaagtacttgttcattagaagaacaccaatgtttgaagtgtaccatgatatt |
5780104 |
T |
 |
| Q |
211 |
acaaccataattgttggccatggaattgagtttttcatcatctgggtcattatggatttgatcaaaattcaata |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5780105 |
acaaccataattgttggccatggaattgagtttttcatcatctgggtcattatggatttgatcaaaattcaata |
5780178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 107 - 191
Target Start/End: Complemental strand, 31330332 - 31330248
Alignment:
| Q |
107 |
tcatgtgacacatggtgagaaaaaccgggaacttgtaaccatagttgcttaacaagtacttgttcattagaagaacaccaatgtt |
191 |
Q |
| |
|
|||| ||||||||||||||||||| || ||||| ||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
31330332 |
tcatatgacacatggtgagaaaaataggatacttgaaaccatagttgcttaacaaatacttgttcaatagaagaacaccaatgtt |
31330248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University