View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19070_high_24 (Length: 250)
Name: NF19070_high_24
Description: NF19070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19070_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 41609085 - 41609319
Alignment:
| Q |
1 |
tttcgacgaagattgatcatcatcactaacaactgtataaactttatacctataatataatacggtgatnnnnnnnnnnnnnnnntacaaaacctttatt |
100 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41609085 |
tttcgacgaaaattgatcaccatcactaacaacggtagaaactttatacctataatataatacggtgataaaaaaaaaa------tacaaaacctttatt |
41609178 |
T |
 |
| Q |
101 |
tattcccgtttgctaagtatatgtatacagcagcctatttatgctccttttgttctggtaacttggttaatgtttgaattcaatcaccttctagttctat |
200 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41609179 |
tattcctgtttgctaagtatatgtatatagcagcctatttatgctccttttgttctggtaacttggttaatgtttgaattcaatcaccttctagttctat |
41609278 |
T |
 |
| Q |
201 |
agttaccatttttgatggctgttagtgccttctagaattat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41609279 |
agttaccatttttgatggctgttagtgccttctagaattat |
41609319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University