View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19070_high_26 (Length: 239)

Name: NF19070_high_26
Description: NF19070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19070_high_26
NF19070_high_26
[»] chr1 (1 HSPs)
chr1 (1-221)||(1196508-1196728)


Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 1196728 - 1196508
Alignment:
1 taacaaaattaatgagcgaaccatctttttgatatttgaatgtgtaaaactatgccatggtaattgttgagtttttgatatttgaatgtgtcttttgtaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1196728 taacaaaattaatgagcgaaccatctttttgatatttgaatgtgtaaaactatgccatggtaattgttgagtttttgatatttgaatgtgtcttttgtaa 1196629  T
101 gttaatttggttcttaaatatatctttctttaatttatttagtacataaaattattagcaaaaggcatattcgaggatgctttaatttcggcacatttaa 200  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1196628 gttaatttggttcttaaatatatctttcgttaatttatttagtacataaaattattagcaaaaggcatattcgaggatgctttaatttcggcacatttaa 1196529  T
201 gaaaatgatagtgacactgtc 221  Q
    |||||||||||||||||||||    
1196528 gaaaatgatagtgacactgtc 1196508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University