View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19070_high_31 (Length: 236)
Name: NF19070_high_31
Description: NF19070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19070_high_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 22 - 220
Target Start/End: Complemental strand, 45195450 - 45195249
Alignment:
| Q |
22 |
gtagttgttcattaatttcgccccccaaaatagcagcttctttattacgcccatccctcattcttttcttctctgattccatactaacctcatcgttgga |
121 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45195450 |
gtagctgtgcattaatttcgccccccaaaatagcagcttctttattacactcatccctcattcttttcttctctgattccatactaacctcatcgttgga |
45195351 |
T |
|
| Q |
122 |
ttcctcctccacgattttaggctcatttgattgctctttaataactgtcttttctgttctgattctccccttc---aatagtaacgaatttcgtattaac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
45195350 |
ttcctcctccacgattttaggctcatttgattgctctttaataactgccttttctgttctgattctccccttcaataatagtaacgaatttcgcattaac |
45195251 |
T |
|
| Q |
219 |
tc |
220 |
Q |
| |
|
|| |
|
|
| T |
45195250 |
tc |
45195249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 63 - 220
Target Start/End: Original strand, 45056165 - 45056322
Alignment:
| Q |
63 |
ttattacgcccatccctcattcttttcttctctgattccatactaacctcatcgttggattcctcctccacgattttaggctcatttgattgctctttaa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45056165 |
ttattacgcccatccctcattcttttcttctctgattccatactaacctcatcgttggattcctcctccacgattttaggctcatttgattgctctttaa |
45056264 |
T |
|
| Q |
163 |
taactgtcttttctgttctgattctccccttcaatagtaacgaatttcgtattaactc |
220 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45056265 |
taactgccttttctgttctgattctccccttcaatagtaacgaatttcgcattaactc |
45056322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University