View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19070_high_32 (Length: 233)
Name: NF19070_high_32
Description: NF19070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19070_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 112 - 215
Target Start/End: Original strand, 8764923 - 8765026
Alignment:
| Q |
112 |
aaggagtagatgctgtcaattgactgaagctttggtgaaaggagtttaaagcaaatactcaaggggtttgattgttgagtatgttacatttatgatttta |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8764923 |
aaggagtagatgttgtcaattgactgaagctttggtgaaaggagtttaaagtaaatactcaaggggtttgattgttgagcatgttacatttatgatttta |
8765022 |
T |
 |
| Q |
212 |
ggtt |
215 |
Q |
| |
|
|||| |
|
|
| T |
8765023 |
ggtt |
8765026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 27 - 58
Target Start/End: Original strand, 8764890 - 8764921
Alignment:
| Q |
27 |
gatgcagatgcagattacagatcctttttgcg |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8764890 |
gatgcagatgcagattacagatcctttttgcg |
8764921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University