View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19070_low_16 (Length: 362)
Name: NF19070_low_16
Description: NF19070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19070_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 345; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 1 - 353
Target Start/End: Original strand, 41621217 - 41621569
Alignment:
| Q |
1 |
gtcatttcgcatgccattgatgattgtccacctttattttggcgtctagttcaaagataaacattgttgtattgcaactcctgtgtccatttcagggatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41621217 |
gtcatttcgcatgccattgatgattgtccacctttattttggcgtctagttcaaagataaacattgttgtattgcaactcctgtgtccatttcagggatg |
41621316 |
T |
 |
| Q |
101 |
ccaaagagccataaccttccctttgtggacctcaaaagcttgagcacaaaatattgtttttgtgctaacatattggccatatttgttcctaatgcaggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41621317 |
ccaaagagccataaccttccctttgtggacctcaaaagcttgagcacaaaatattgtttttgtgctaacatattggccatatttgttcctaatgcaggtt |
41621416 |
T |
 |
| Q |
201 |
cccaatcccatgcctcctatatcgcatgagaatgcaacatcagtattgcatttcacaaacctgccagtggcttcgaccaatgtgtggtctgcattctgtc |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41621417 |
cccaatcccatgcctcctatatcgtatgagaatgcaacatcagtattgcatttcacaaacctgctagtggcttcgaccaatgtgtggtctgcattctgtc |
41621516 |
T |
 |
| Q |
301 |
atttgtgatatgcctgcttagagctgcaacattgccttctgtttttgcctttg |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41621517 |
atttgtgatatgcctgcttagagctgcaacattgccttctgtttttgcctttg |
41621569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 76
Target Start/End: Original strand, 41621044 - 41621107
Alignment:
| Q |
12 |
tgccattgatgattgtccacctttattttggcgtctagttcaaagataaacattgttgtattgca |
76 |
Q |
| |
|
||||||||||| | |||||| || |||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
41621044 |
tgccattgatgct-gtccactattgttttggcgtctaattcaaagattaacattgttgtattgca |
41621107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University