View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19070_low_29 (Length: 238)
Name: NF19070_low_29
Description: NF19070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19070_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 59 - 207
Target Start/End: Complemental strand, 6137979 - 6137831
Alignment:
| Q |
59 |
tatatatcaacacaaacatagacatctgatattgtcatcgcgctaacggtgatatgtagacaccaataataatttgataaaatgaacgtaatcacatata |
158 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6137979 |
tatatatcaacacaaacatagacatatgatattgtcatagcgctaacggtgatatgtagacaccaataataatttgataaaatgaacgtaatcacatata |
6137880 |
T |
 |
| Q |
159 |
tagatgactgtcgtgttgaacactaacatgccactgaatatttttgatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6137879 |
tagatgactgtcgtgttgaacactaacatgtcactgaatatttttgatc |
6137831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 6138044 - 6137997
Alignment:
| Q |
18 |
ccattctagcttcttacctgcatgtaggccacaataacaattatatat |
65 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6138044 |
ccattctagcttcttacctgcatttaggccacaataacaattatatat |
6137997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 26 - 83
Target Start/End: Complemental strand, 30193483 - 30193426
Alignment:
| Q |
26 |
gcttcttacctgcatgtaggccacaataacaattatatatcaacacaaacatagacat |
83 |
Q |
| |
|
|||||||||||||||| | |||| || ||||| | |||||||||| |||||||||||| |
|
|
| T |
30193483 |
gcttcttacctgcatgcacgccataacaacaactgtatatcaacataaacatagacat |
30193426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 140
Target Start/End: Complemental strand, 30193399 - 30193371
Alignment:
| Q |
112 |
atgtagacaccaataataatttgataaaa |
140 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30193399 |
atgtagacaccaataataatttgataaaa |
30193371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University