View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19070_low_30 (Length: 238)
Name: NF19070_low_30
Description: NF19070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19070_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 4 - 223
Target Start/End: Original strand, 31844840 - 31845059
Alignment:
| Q |
4 |
gcttgagaagaaaaacgatgtgaatgtgatgatgaagagggtaatagggatatttgagtatatatcatgagacaatttagtatgatagaaataataaaga |
103 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31844840 |
gcttgagaagaaaaacggtgtgaatgtgatgatgaagagggtagtagggatatttgagtatatatcatgagacaatttagtatgatagaaataataaaga |
31844939 |
T |
|
| Q |
104 |
gttattataatagaaaaagagggaatcctattgtgtgagtttggtcattacttactaattttggaactgccagggttacaaaactttatgccatatttct |
203 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31844940 |
gttattataatagaaagagagggaatcctattgtgtgagtttggtcattatttactaaatttggaactgccagggttacaaaactttatgccatatttct |
31845039 |
T |
|
| Q |
204 |
gtcactggtcaagttaacat |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31845040 |
gtcactggtcaagttaacat |
31845059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University