View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19070_low_31 (Length: 237)
Name: NF19070_low_31
Description: NF19070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19070_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 45031667 - 45031818
Alignment:
| Q |
1 |
agatgaattgcaaaaggatacttctactcatgaaacagatactgcaataagcagaaatggtatgaaacaactcaatgatttcttcatgacatgagagtcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45031667 |
agatgaattgcaaaaggatacttctactcatgaaacagatactgcaataagcagaaatggtatgaaacaacttaatgatttcttcatgacatgagagtcg |
45031766 |
T |
|
| Q |
101 |
gtaagtcatgtaaagtttgcagaagggcgtttaggagggggctcaattttct |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45031767 |
gtaagtcatgtaaagtttgcagaagggcgtttaggagggggctcaattttct |
45031818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 2 - 222
Target Start/End: Original strand, 38205013 - 38205234
Alignment:
| Q |
2 |
gatgaattgcaaaaggatacttctactcatgaaacagatactgcaataagcagaaatggtatgaaacaactcaatgatttcttcatgacatgagagtcgg |
101 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||||| | ||||||||| |||| || |
|
|
| T |
38205013 |
gatgaattgcaaaaggatccttctactcatgaaacagatactgcaataagcagaaagggtttgaaacagctcaatgatcttttcatgacaggagaatcaa |
38205112 |
T |
|
| Q |
102 |
taagtcatgtaaagtttgcagaagggcgt-ttaggagggggctcaattttcttgacatagtggatactaatagactaaatgatggaagccatgatactag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||| || ||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
38205113 |
taagtcatgtaaagtttgcagaagggcgtgctagaagggggctcaatttttttgacccagaggaaactaatggactaaacaatggaagccatgatactga |
38205212 |
T |
|
| Q |
201 |
gaatcatgctgtatctgattcc |
222 |
Q |
| |
|
|||||||| ||||||||||| |
|
|
| T |
38205213 |
gaatcatgtcttatctgattcc |
38205234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University