View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19070_low_34 (Length: 233)

Name: NF19070_low_34
Description: NF19070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19070_low_34
NF19070_low_34
[»] chr1 (2 HSPs)
chr1 (112-215)||(8764923-8765026)
chr1 (27-58)||(8764890-8764921)


Alignment Details
Target: chr1 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 112 - 215
Target Start/End: Original strand, 8764923 - 8765026
Alignment:
112 aaggagtagatgctgtcaattgactgaagctttggtgaaaggagtttaaagcaaatactcaaggggtttgattgttgagtatgttacatttatgatttta 211  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||    
8764923 aaggagtagatgttgtcaattgactgaagctttggtgaaaggagtttaaagtaaatactcaaggggtttgattgttgagcatgttacatttatgatttta 8765022  T
212 ggtt 215  Q
    ||||    
8765023 ggtt 8765026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 27 - 58
Target Start/End: Original strand, 8764890 - 8764921
Alignment:
27 gatgcagatgcagattacagatcctttttgcg 58  Q
    ||||||||||||||||||||||||||||||||    
8764890 gatgcagatgcagattacagatcctttttgcg 8764921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University