View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19073_high_28 (Length: 265)
Name: NF19073_high_28
Description: NF19073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19073_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 7056261 - 7056090
Alignment:
| Q |
19 |
gtgtttggaaccacatttgggatccctccaaagtttaaacgtacgaaattgaaatgctccaatttatagcctttatgcactggtaactgtgagagacgtg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
7056261 |
gtgtttggaaccacatttgggatccctccaacgtttaaacgtacgaaattgaa-tgctccaatttagagcctttatgcactggtaactgtgaga--cgtg |
7056165 |
T |
 |
| Q |
119 |
agtttgggatacaaaacggcaaaccagacacatactagttaacgaatttacgttaagatatgtagcaatatttaac |
194 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7056164 |
agtttggg-tacaaaacggcaaaccagacacatactagttaacgaatttacgttaagatatgtagcaatatttaac |
7056090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 210 - 241
Target Start/End: Complemental strand, 7056088 - 7056057
Alignment:
| Q |
210 |
tactgttggtgcaggcggcagttgtgaaaacc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7056088 |
tactgttggtgcaggcggcagttgtgaaaacc |
7056057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University