View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19073_high_38 (Length: 205)
Name: NF19073_high_38
Description: NF19073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19073_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 105 - 188
Target Start/End: Original strand, 40994419 - 40994502
Alignment:
| Q |
105 |
tgacttgaaagaattatgcaatctaactagtagtaattagcactatgagtgatttgaaatcacgcagtcaataattgtgtgatc |
188 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||| |
|
|
| T |
40994419 |
tgacttgaaagagttatggaatctaactagtagtaattagcactatgagtgatttgaaatcacgcacttaataactgtgtgatc |
40994502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 11 - 52
Target Start/End: Original strand, 40994325 - 40994366
Alignment:
| Q |
11 |
gtgagaagaaatacttgcaagattacattggtaatagcctag |
52 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40994325 |
gtgaaaagaaatacttgcaagattacattggtaatagcctag |
40994366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University