View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19073_high_4 (Length: 652)
Name: NF19073_high_4
Description: NF19073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19073_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 2e-54; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 2e-54
Query Start/End: Original strand, 104 - 224
Target Start/End: Complemental strand, 33328718 - 33328598
Alignment:
| Q |
104 |
acaatagagatgcatacctttgaggtgatggtaactgcttgatcatgataactgatgataatattgtccatcacatcactaatattcaaaacaaactccg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33328718 |
acaatagagatgcatacctttgaggtgatggtaattgcttgatcatgataactgatgataatattgtccatcacatcactaatattcaaaacaacctccg |
33328619 |
T |
|
| Q |
204 |
tggaagagagtaaggatcatc |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33328618 |
cggaagagagtaaggatcatc |
33328598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 9e-38
Query Start/End: Original strand, 17 - 97
Target Start/End: Complemental strand, 33328833 - 33328753
Alignment:
| Q |
17 |
tgaacattgaaaagtaagcataattggtatttccttgcaacgagagcaaaataatattcaagtaaaatcttgccttttaaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33328833 |
tgaacattgaaaagtaagcataattggtatttccttgcaacgagagcaaaataatattcaagtaaaatcttgccttttaaa |
33328753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 600 - 639
Target Start/End: Complemental strand, 33328474 - 33328435
Alignment:
| Q |
600 |
tgaaatattatgtactcaagatccacgcgtatgcatcttc |
639 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33328474 |
tgaaatattatgtactcaagatccacgcatatgcatcttc |
33328435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University