View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19073_low_19 (Length: 358)
Name: NF19073_low_19
Description: NF19073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19073_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 156 - 346
Target Start/End: Original strand, 32956891 - 32957081
Alignment:
| Q |
156 |
ttgattgggtagtcaaaagtgggcacgtgacagagggaacagtcttccaggatctgccttcttcgatcacgaggcttttatttagctttactaaatccaa |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32956891 |
ttgattgggtagtcaaaagtgggcacgtgacagagggaacagtcttccaggatctgccttcttcgatcacgaggcttttatttagctttactaaatccaa |
32956990 |
T |
 |
| Q |
256 |
ttctattcataaactctgtattcgtatctctctgcccccagagaaaatggaatactactacttcccttttcctctcttctttcttttctgc |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32956991 |
ttctattcataaactctgtattcgtatctctctgcccccaaagaaaatggaatactactacttcccttttcctctcttctttcttttctgc |
32957081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 26 - 90
Target Start/End: Original strand, 32956761 - 32956825
Alignment:
| Q |
26 |
ttggtgatgaatgagtgtgacaatattagtatgttgcaatgttgtatgaaatggtttgaatttat |
90 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32956761 |
ttggtgatgaatgattgtgacaatattagtatgttgcaatgttgtatgaaatggtttgaatttat |
32956825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University