View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19073_low_30 (Length: 251)
Name: NF19073_low_30
Description: NF19073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19073_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 28260936 - 28261168
Alignment:
| Q |
1 |
cttgcagggtaaaacttgagctatacaacaaaaatggcttctgttatatcaagagccgtaaggtttgcataatcttccctttaacattgtaattaatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28260936 |
cttgcagggtaaaacttgagctatacaacaaaaatggcttctgttatatcaagagccgtaaggtttgcataatcttccctttaacattgtaattaatatg |
28261035 |
T |
|
| Q |
101 |
acttatcagcttaagaaattatatttctattgtactatatcatttattttcaacttcgtttccttatttctaattccgatgaagtagcccagtggtatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28261036 |
acttatcagcttaagaaattatatttctattgtactatatcatttattttcaacttcgtttccttatttctaattccgatgaagtagcccagtggtatga |
28261135 |
T |
|
| Q |
201 |
gttgatacatcgaatgagttctatatagacggt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28261136 |
gttgatacatcgaatgagttctatatagacggt |
28261168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University