View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19073_low_42 (Length: 202)
Name: NF19073_low_42
Description: NF19073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19073_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 66 - 186
Target Start/End: Original strand, 51754989 - 51755109
Alignment:
| Q |
66 |
gagggccatggaacatgaaattggtaaatgaaaaagagaaaatattcaatatatgaggctgattatggacatcatgttgtgtaaaaggaattagccaaat |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51754989 |
gagggccatggaacatgaaattggtaaatgaaaaagagaaaatattcaatatatgaggctgattatggacatcatgttgtgtaaaaggaattagccaaat |
51755088 |
T |
|
| Q |
166 |
cactcccacatcatctccatg |
186 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
51755089 |
cactcccacatcatccccatg |
51755109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University